Background and Aim: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.

Materials and Methods: The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.

Results: The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.

Conclusion: Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Keywords: hemagglutinin-neuraminidase, Newcastle disease, protein, reverse transcriptase polymerase chain reaction, sequencing, vaccination, virus.

1. Alexander, D.J., Aldous, E.W. and Chad, M.F. (2012) The long view: A selected review of 40 years of Newcastle disease research. Avian Pathol., 41: 329-335. [Crossref] [PubMed]

2. Sa'idu, L. and Abdu, P.A. (2008) Outbreak of viscerotropic velogenic form of Newcastle disease in vaccinated six weeks old pullets. Sokoto J. Vet. Sci., 7: 37-40.

3. OIE-World Organisation for Animal Health. (1996) Newcastle disease. In: Manual of Standards for Diagnostic Test and Vaccines. 3rd ed. OIE, Paris. p161-169.

4. Kencana, G.A.Y. (2012) Penyakit Virus Unggas. Udayana University Press, Denpasar. p30-40.

5. Darminto, S.M. (2005) Kajian Newcastle Disease pada itik dan upaya pengendaliannya. Wartazoa, 15: 84-94.

6. Wibowo, M.H. and Amanu, S. (2010) Perbandingan beberapa program vaksinasi penyakit Newcastle pada ayam buras. J. Sains Vet., 28: 27-35.

7. Dharmayanti, I., Hartawan, R., Hewajuli, D.A. and Indriani, R. (2014) Phylogenetic analysis of genotype VII of Newcastle Disease virus in Indonesia. Afr. J. Microbiol. Res., 8: 1368-1374. [Crossref]

8. Kraneveld, F.C. (1926) A poultry disease in the Dutch East Indies, Nederlands-Indische. Bl. Voor Diergeneeskd., 38: 448-451.

9. Doyle, T.M. (1927) A hit her to unrecorded disease of fowl due to a filter passing virus. J. Comp. Pathol. Ther., 40: 144-169.

10. Ashraf, A. and Shah, M. (2014) Newcastle disease: Present status and future challenges for developing countries. Afr. J. Microbiol. Res., 8: 411-416. [Crossref]

11. Naveen, K.A., Singh, S.D., Kataria, J.M., Barathidasan, R. and Dhama, K. (2013) Detection and differentiation of pigeon paramyxovirus serotype-1(PPMV-1) isolates by RT-PCR and restriction enzyme analysis. Trop. Anim. Health Pro., 45: 1231-1236. [Crossref] [PubMed]

12. Dimitrv, K.M., Afonso, C.L., Yu, Q. and Miller, P.J. (2017) Newcastle disease vaccines-A solved problem or a continuous challenge? Vet. Microbiol., 206: 126-136. [Crossref] [PubMed]

13. Xiao, S., Paldurai, A., Nayak, B., Samuel, A., Bharoto, A.E., Prajitno, T.Y., Collins, P.L. and Samal, S.K. (2012) Complete genome sequences of Newcastle disease virus strains circulating in chiken populations of Indonesia. J. Virol., 86: 5969-5970. [Crossref] [PubMed] [PMC]

14. Darminto and Ronohardjo, P. (1996) Newcastle Disease pada Unggas di Indonesia: Situasi Terakhir dan Relevansinya terhadap Pengendalian Penyakit. Balai Penelitian Veteriner. p65-84.

15. Cattoli, G., Susta, L., Terregino, C. and Brown, C. (2011) Newcastle disease: A Shahid and Liaquat 366 review of field recognition and current methods of laboratory detection. J. Vet. Diagn. Invest., 23: 637-656. [Crossref]

16. Miller, P.J. and Koch, G. (2013) Newcastle disease. In: Swayne, D.E., Glisson, J.R., McDougald, L.R., Nolan, L.K., Suarez, D.L.O. and Nair, V.N., editors. Diseases of Poultry. 13th ed. John Wiley & Sons, Athens. p89-107.

17. Lamb, R.A. and Parks, G.D. (2007) Paramyxoviridae: The viruses and their replication. In: Fields, B.N., Knipe, D.N. and Howley, P.M., editors. Fields Virology. 5th ed. Lippincott, Williams, and Wilkins, Philadelphia. p1449-1496.

18. Cao, Y., Gu, M., Zhang, X., Liu, W. and Liu, X. (2013) Complete genome sequences of two Newcastle disease virus strains of genotype VIII. J. Genome Announcement, 1: e00180-12. [Crossref]

19. Zhang, Y.Y., Shao, M.Y., Yu, X.H., Zhao, J. and Zhang, G.Z. (2014) Molecular characterization of chicken-derived genotype VIId Newcastle Disease virus isolates in China during 2005-2012 reveals a new length in hemagglutinin-neuraminidase. Infect. Genet. Evol., 21: 359-366. [Crossref]

20. Panda, A., Huang, Z., Elankumaran, S., Rockemann, D.D. and Samal, S.K. (2004) Role of fusion protein cleavage site in the virulence of Newcastle disease virus. Microb. Pathog., 36: 1-10. [Crossref] [PubMed]

21. Connaris, H., Takimoto, T., Russell, R., Crennell, S., Moustafa, I., Portner, A. and Taylor, G. (2002) Probing the sialic acid binding site of the hemagglutinin-neuraminidase of Newcastle disease virus: Identification of key amino acids involved in cell binding, catalysis and fusion. J. Virol., 76: 1816-1824. [Crossref]

22. Connolly, S.A., Leser, G.P., Jardetzky, T.S. and Lamb, R.A. (2009) Bimolecular complementation of paramyxovirus fusion and hemagglutinin-neuraminidase proteins enhances fusion: Implications for the mechanism of fusion triggering. J. Virol., 83: 10857-10868. [Crossref]

23. Kim, S.H., Subbiah, M., Samuel, A.S., Collins, P.L. and Samal, S.K. (2011) Roles of the fusion and hemagglutinin-neuraminidase proteins in replication, tropism, and pathogenicity of avian paramyxoviruses. J. Virol., 85: 8582-8596. [Crossref] [PubMed] [PMC]

24. Huang, Z., Panda, A., Elankumaran, S., Govindarajan, D., Rockemann, D.D. and Samal, S.K. (2004) The hemagglutinin-neuraminidase protein of Newcastle disease virus determines tropism and virulence. J. Virol., 78: 4176-4184. [Crossref] [PubMed] [PMC]

25. Porotto, M., Salah, Z., DeVito, I., Talekar, A., Palmer, S.G., Xu, R., Wilson, I.A. and Moscona, A. (2012) The second receptor binding site of the globular head of the Newcastle disease virus hemagglutinin-neuraminidase activates the stalk of multiple paramyxovirus receptor binding proteins to trigger fusion. J. Virol., 86: 5730-5741. [Crossref]

26. Heiden, S., Grund, C., Roder A., Granzow, H., Kuhnel, D., Mettenleiter, T.C. and Romer-Obedorfer, A. (2014) Different regions of the Newcastle Disease virus fusion protein modulate pathogenicity. PLoS One, 9: e113344. [Crossref]

27. Murulitharan, K., Yusoff, K., Omar, A.R. and Molouki, A. (2013) Characterization of Malaysian velogenic NDV strain AF2240-I genomic sequence: A comparative study. Virus Genes, 46: 431-440. [Crossref] [PubMed]

28. Jin, J., Zhao, J., Ren, Y., Zhong, Q. and Zhang, G. (2016) Contribution of HN protein length diversity to Newcastle Disease virus virulence, replication and biological activities. Sci. Rep., 6: 36890. [Crossref] [PubMed] [PMC]

29. Iorio, R.M., Syddall, R.J., Sheehan, J.P., Bratt, M.A., Glickman, R.L. and Riel, A.M. (1991) Neutralization map of the hemagglutinin-neuraminidase glycoprotein of Newcastle Disease virus: Domains recognized by monoclonal antibodies that prevent receptor recognition. J. Virol., 65: 4999-5006. [PubMed] [PMC]

30. Mahon, P.J., Mirza, A.M. and Iorio, R.M. (2011) Role of the two sialic acid binding sites on the Newcastle Disease virus HN Protein in triggering the interaction with the F protein required for the promotion of fusion. J. Virol., 85: 12079-12082. [Crossref]

31. Hu, S., Ma, H., Wu, Y., Liu, W., Wang, X., Liu, Y. and Liu, X. (2010) A vaccine candidate of attenuated genotype VII Newcastle Disease virus generated by reverse genetics. Vaccine, 27: 904-910. [Crossref] [PubMed]

32. Cho, S.H., Kwon, H.J., Kim, T.E., Kim, J.H., Yoo, H.S., Park, M.H., Park, Y.H. and Kim, S.J., (2008) Characterization of a recombinant Newcastle Disease vaccine strain. Clin. Vaccine Immunol., 15: 1572-1579. [Crossref] [PubMed] [PMC]

33. Kang, Y., Li, Y., Yuan, R., Sun, M., Wang, Z., Feng, M., Jiao, P. and Ren, T. (2014) Phylogenetic variation of two Newcastle Disease viruses isolated from domestic ducks in Southern China. Virol. J., 11: 147. [Crossref] [PubMed] [PMC]

34. Kapczynski, D.R. and King, D.J. (2005) Protection of chickens against overt clinical disease and determination of viral shedding following vaccination with commercially available Newcastle Disease virus vaccines upon challenge with highly virulent virus from the California 2002 exotic Newcastle disease outbreak. Vaccine, 23: 3424-3433. [Crossref] [PubMed]

35. Fentie, T., Dadi, K., Kassa, T., Sahle, M. and Cattoli, G. (2014) Effect of vaccination on transmission characteristics of highly virulent Newcastle disease virus experimentally infected chickens. Avian Pathol., 43: 420-426. [Crossref] [PubMed]

36. Shabbir, M.Z., Zohari, S., Yaqub, T., Nazir, J., Shabbir, M.A.B., Mukhtar, N., Shafee, M., Sajid, M., Anees, M., Abbas, M., Khan, M.T. Ali, A.A., Ghafoor, A., Ahad, A., Chana, A.A., Anjum, A.A., Hussain, N., Ahmad, A., Goraya, M.U., Iqbal, Z., Khan, S.A., Aslam, H., Zehra, K., Sohail, M.U., Yaqub, W., Ahmad, N., Berg, M. and Munir, M. (2013) Genetic diversity of Newcastle Disease virus in Pakistan: A countrywide perspective. Virol. J., 10: 170. [Crossref]

37. Yune, N. and Abdela, N. (2017) Update on epidemiology, diagnosis and control technique of Newcastle Disease. J. Vet. Sci. Tech., 8: 429. [Crossref]

38. Roohani, K., Tan, S.W., Yeap, S.K., Ideris, A., Bejo, M.H. and Omar, A.R. (2015) Characterization of genotype VII Newcastle Disease virus (NDV) isolated from NDV vaccinated chickens and the efficacy of LaSota and recombination genotype VII vaccines against challenge with velogenic NDV. J. Vet. Sci., 16: 447-457. [Crossref] [PubMed] [PMC]

39. Emilia, A., Setyaningsih, S. and Soejoedono, R.D. (2015) Isolasi dan karakteristik biologik virus Newcastle Disease. J. Kedokteran Hewan, 9: 47-51.

40. Cornax, I., Miller, P.J. and Afonso, C.L. (2012) Characterization of live LaSota vaccine strain-induced protection in chickens upon early challenge with a virulent Newcastle disease virus of heterologous genotype. Avian Dis., 56: 464-470. [Crossref] [PubMed]

41. OIE-World Organisation for Animal Health, (2012) Newcastle disease. In: Manual of Diagnostic Tests and Vaccines for Terrestrial Animals: Mammals, Birds and Bees. Biological Standards Commission-World Organisation for Animal Health, Paris, France. p555-574.

42. Kumar, S., Tamura, K. and Nei, M. (1994) MEGA: Molecular evolutionary genetics analysis software for microcomputers. Comput. Appl. Biosci., 10: 189-191. [Crossref]

43. Kumar, S., Glen, S. and Koichiro, T. (2016) MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol., 33: 1870-1874. [Crossref] [PubMed]

44. Cosset, F.L., Bouquet, J.F., Drynda, A., Chebloune, Y., Rey-Senelonge, A., Kohen, G., Nigon, V.M., Desmettre, P. and Verdier, G. (1991) Newcastle Disease virus (NDV) vaccine based on immunization with avian cells expressing the NDV-hemagglutinin-neuraminidase glycoprotein. Virology, 185: 862-866. [Crossref]

45. Gu, M., Liu, W., Xu, L., Cao, Y., Yao, C., Hu, S. and Liu, X. (2011) Positive selection in the hemagglutinin-neuraminidase gene of Newcastle Disease virus and its effect on vaccine efficacy. Virol. J., 8: 150. [Crossref] [PubMed] [PMC]

46. Miller, P.J. and Koch, G. (2013) Newcastle disease. In: Swayne, D.E., Glisson, J.R., McDougald, L.R., Nolan, L.K., Suarez, D.L. and Nair, V., editors. Diseases of Poultry. 13th ed. Wiley-Blackwell, Hoboken, NJ. p89-138.

47. Nakamura, K., Ito, M., Nakamura, T., Yamamoto, Y., Yamada, M., Mase, M. and Imai, K. (2014) Pathogenesis of Newcastle disease in vaccinated chickens: Pathogenicity of isolated virus and vaccine effect on challenge of its virus. J. Vet. Med. Sci., 76: 31-36. [Crossref]

48. Liu, X.F., Wan, H.Q., Ni, X.X., Wu, Y.T. and Liu, W.B. (2003) Pathotypical and genotypical characterization of strains of Newcastle Disease virus isolated from outbreaks in chicken and goose ?ocks in some regions of China during 1985-2001. Arch. Virol., 148: 1387-1403. [PubMed]

49. Zhu, J., Hu, S., Xu, H., Liu, J., Zhao, Z., Wang, X. and Liu, X. (2016) Characterization of virulent Newcastle Disease viruses from vaccinated chicken flocks in Eastern China. BMC Vet. Res., 12: 113. [Crossref] [PubMed] [PMC]

50. Rehmani, S. F., Wajid, A., Basharat, A., Bibi, T. and Arif, S. (2016) Newcastle disease virus isolate backyard/Pakistan/Lahore/SFR-144E/2016, complete genome. Gen Bank, 2016: Accession KX791188.1.

51. Habib, H., Reihmani, S.F., Mukhtar, N., Bibi, T. and Wajid, A. (2015) Biological and molecular characterization of Newcastle Disease virus through haemaglutinin-neuraminidase gene isolated from Lahore district. J. Inf. Mol. Biol., 3: 28-33. [Crossref]

52. Liu, J., Zhu, J., Xu, H., Li, J., Hu, Z., Hu, S. and Liu, X. (2017) Effects of the HN antigenic difference between the vaccine strain and the challenge strain of Newcastle Disease virus on virus shedding and transmission. Viruses, 9: 225. [Crossref] [PubMed] [PMC]

53. Jeon, W.J., Lee, E.K., Lee, Y.J., Jeong, O.M., Kim, Y.J., Kwon, J.H. and Choi, K.S. (2008) Protective efficacy of commercial inactivated Newcastle disease virus vaccines in chickens against a recent Korean epizootic strain. J. Vet. Sci., 9: 295-300. [Crossref] [PubMed] [PMC]

54. Samuel, A., Nayak, B., Paldurai, A., Xiao, S., Aplogan, G.L., Awoume, K.A., Webby, R.J., Ducates, M.F., Collins, P.L. and Samal, S.K. (2013) Phylogenetic and pathotypic characterization of Newcastle Disease viruses circulating in West Africa and efficacy of a current vaccine. J. Clin. Microbiol., 51: 771-781. [Crossref] [PubMed] [PMC]

55. Byarugaba, D.K., Mugimba, K.K., Omony, J.B., Oktiwi, M., Wanyana, A., Otim, M.O., Kirunda, H., Nakavuma, J.L., Teillaud, A., Paul, M.C. and Ducatez, M.F. (2014) High pathogenicity and low genetic evolution of avian paramyxovirus type I (Newcastle Disease virus) isolated from live bird markets in Uganda. Virol. J., 11: 173. [Crossref]

56. Wang, J., Yan, L., Zhang, Y., Zhao, Y., Castellan, D., Liu, H. and Wang, Z. (2016) Genomic characterization of a Newcastle Disease virus isolated from ducks in live bird markets in China. PLoS One, 11: e0158771. [Crossref]

57. Yang, H.M., Zhao, J., Xue, J., Yang, Y. Zhang, G. (2017) Antigenic variation of LaSota and genotype VII Newcastle Disease virus (NDV) and their efficacy against challenge with velogenic NDV. Vaccine, 35: 27-32. [Crossref] [PubMed]

58. Ewies, S.S., Ali, A., Tamam, S.M. and Madbouly, H.M. (2017) Molecular characterization of Newcastle disease virus (genotype VII) from broiler chickens in Egypt. Beni Suef Univ. J. Basic Appl. Sci., 6: 232-237. [Crossref]

59. Garcia, S.C., Diel, D.G., Susta, L., Decanini, E.L., Yu, Q., Brown, C.C., Miller, P.J. and Afonso, C.L. (2015) Development of an improved vaccine evaluation protocol to compare the efficacy of Newcastle Disease vaccines. Biologicals, 43: 136-145. [Crossref] [PubMed]

60. Mohamed, M.H., Abdelaziz, A., Kumar, S., Al-Habib, M. and Mehahed, M.M. (2016) Effect of phylogenetic diversity of velogenic Newcastle disease virus challenge on virus shedding post homologous and heterologous DNA vaccination in chickens. Avian Pathol., 45: 228-234. [Crossref]

61. Sarcheshmei, M., Dadras, H., Mosleh, N. and Mehrabanpour, M.J. (2016) Comparative evaluation of the protective efficacy of different vaccination programs against a virulent field strain of the Newcastle Disease virus in broilers. Braz. J. Poultry Sci., 18: 363-370. [Crossref]

---