Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia

Vet World Vol.13 May-2020 Article-11

Research Article

Veterinary World, 13(5): 905-908

https://doi.org/10.14202/vetworld.2020.905-908

G. Y. Suryawan¹, I. W. Suardana², and I. N. Wandia³

1. Department of Veterinary Medicine, Faculty of Veterinary Medicine, Udayana University, Jl. PB. Sudirman, Denpasar, Bali, Indonesia.
2. Department of Preventive Veterinary Medicine, Laboratory of Veterinary Public Health, Faculty of Veterinary Medicine, Udayana University, Jl. PB. Sudirman, Denpasar, Bali, Indonesia.
3. Department of Basic Veterinary Medicine, Laboratory of Veterinary Anatomy, Faculty of Veterinary Medicine, Udayana University, Jl. PB. Sudirman, Denpasar, Bali, Indonesia.

Background and Aim: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs.

Materials and Methods: Beef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5'CATGGGGACGAGGACTATACTATG '3 and reverse primer: 5'GTAGTCCCAATGTAAGGGATAGCTG'3.

Results: Our study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs.

Conclusion: The PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia. Keywords: beef meatball, food safety, polymerase chain reaction method, public health, rat meat, sensitivity.

Keywords: beef meatball, food safety, polymerase chain reaction method, public health, rat meat, sensitivity.

How to cite this article: Suryawan GY, Suardana IW, Wandia IN (2020) Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia, Veterinary World, 13(5): 905-908.

Received: 25-12-2019 Accepted: 07-04-2020 Published online: 15-05-2020

Corresponding author: I. W. Suardana E-mail: wayan_suardana@unud.ac.id

DOI: 10.14202/vetworld.2020.905-908

Copyright: Suryawan, et al. This article is an open access article distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http:// creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.