ABSTRACT
Background and Aim:
Materials and Methods: A cross-sectional study was conducted from March to November 2025 using 680 samples collected from imported beef cattle at five quarantine facilities in West Java and Banten, Indonesia. Samples included 650 rectal fecal specimens and 30 environmental samples. Isolation and identification of
Results: Of the 680 samples examined, 16 (2.35%) were confirmed as
Conclusion: Imported beef cattle during quarantine in Indonesia carried
Keywords: antimicrobial resistance genes, biosecurity surveillance, genotype–phenotype discordance, imported beef cattle,
INTRODUCTION
Indonesia relies heavily on imported beef cattle to meet the growing domestic demand for meat, with Australia as one of the primary exporters [5]. During importation, cattle are temporarily housed in designated quarantine facilities, where inspection, observation, and biosecurity procedures are implemented before distribution, as regulated by the Indonesian Quarantine Law [6]. Previous surveillance studies conducted in Australia reported that the prevalence of
Indonesia represents one of the largest destinations for Australian live cattle imports, and quarantine facilities constitute a critical control point for preventing the introduction and dissemination of zoonotic pathogens and AMR determinants through international livestock trade. Monitoring AMR in imported cattle is essential not only for animal health management but also for environmental and public health protection. Livestock-associated bacteria carrying AMR determinants may disseminate resistance genes into the surrounding environment through fecal contamination, wastewater, and farm residues, thereby facilitating the circulation of resistance determinants among animal, human, and environmental microbial communities within a One Health framework [2, 10, 11]. Therefore, surveillance of AMR during quarantine is essential for strengthening biosecurity systems and minimizing the environmental dissemination of AMR determinants [4].
Several studies have reported discrepancies between genotypic and phenotypic AMR profiles in
Cattle are recognized as important reservoirs of
Therefore, this study was conducted to determine the prevalence of
MATERIALS AND METHODS
Ethical approval
The study protocol involving imported beef cattle was reviewed and approved by the Research Ethics Committee of the Faculty of Veterinary Medicine, Universitas Gadjah Mada, Yogyakarta, Indonesia (Approval No. 28/EC-FKH/int./2025; approved on May 7, 2025). All sampling procedures were conducted in accordance with institutional ethical standards and national regulations governing animal handling and quarantine procedures in Indonesia. Rectal fecal sampling and environmental specimen collection were performed by trained personnel under veterinary supervision to minimize animal stress and avoid unnecessary discomfort. The study also adhered to the ARRIVE 2.0 guidelines for reporting
Study period and location
This study was conducted from March to November 2025 at five quarantine facilities under the jurisdiction of the DKI Jakarta Quarantine Office in Indonesia, where imported Australian beef cattle were temporarily housed during mandatory quarantine before distribution. The study locations included facilities A (Cianjur, West Java), B (Sukabumi, West Java), C (Purwakarta, West Java), D (Serang, Banten), and E (Bandung Barat, West Java). These quarantine facilities were selected because they actively received consignments of imported beef cattle during the study period and served as major receiving points within Indonesia’s live cattle importation system. The geographic distribution of the study locations is shown in Figure 1, and the approximate geographic coordinates of each facility are provided in Supplementary Table S1. Laboratory analyses were conducted at the Veterinary Public Health Laboratory, Faculty of Veterinary Medicine, Universitas Gadjah Mada, Yogyakarta, Indonesia.
Figure 1. Geographic distribution of the five quarantine facilities included in this study located in West Java and Banten Provinces, Indonesia, used for sampling imported Australian beef cattle during quarantine. The map was generated using ArcGIS Pro version 3.3.2 (Esri, Redlands, CA, USA).
Study design
A cross-sectional study design was used to investigate the prevalence, virulence characteristics, phenotypic antimicrobial susceptibility, and determinants of AMR in
Sample size determination
Sample collection was performed during the mandatory quarantine period immediately after cattle arrival at the quarantine facilities. The minimum required sample size for fecal sampling was calculated using the formula:
where P represents the expected apparent prevalence, Q = 1 − P, and L represents the desired absolute precision [16]. The expected apparent prevalence of Shiga toxin-producing
In the present study, fecal samples were collected from cattle distributed across five quarantine facilities, with 130 samples collected from each facility. In addition, six environmental samples were collected from each facility, resulting in a total of 680 samples included in this study.
Sample collection
A total of 680 samples were collected, comprising 650 rectal fecal specimens from imported Australian beef cattle and 30 environmental specimens, including soil (n = 20), drinking water (n = 5), and wastewater (n = 5). Fecal specimens (approximately 50 g) were collected rectally from individual cattle using sterile disposable gloves. Soil specimens (approximately 50 g) were collected from the corners of cattle pens, whereas drinking water and wastewater specimens (100 mL) were collected from drinking troughs and wastewater holding ponds within the quarantine facilities using sterile conical tubes.
All samples were transported to the laboratory in cool boxes containing ice packs and processed immediately upon arrival. Environmental sampling was incorporated to evaluate potential contamination associated with imported cattle during quarantine and to assess possible spillover pathways of zoonotic bacteria and AMR determinants within live-animal import systems.
Isolation and conventional identification of E. coli
Sample preparation was performed by homogenizing 10 g of fecal and soil specimens with 90 mL of Buffered Peptone Water (BPW; Oxoid CM0509, Oxoid, Hampshire, UK) using a stomacher. For water samples, an initial filtration step was performed using a 0.45 µm mixed cellulose membrane filter (Millipore, Merck Millipore, Darmstadt, Germany). Subsequently, 10 mL of the filtrate was transferred into 90 mL of BPW for enrichment. The homogenized samples were incubated at 37 ± 1°C for 18–24 h.
After enrichment, a loopful of culture was streaked onto Eosin Methylene Blue agar (EMB agar; Oxoid CM0069B, Oxoid, Hampshire, UK) to identify lactose-fermenting
Biochemical confirmation included Indole medium (HiMedia M463-500G, HiMedia Laboratories, Mumbai, India), methyl red and Voges–Proskauer medium (HiMedia GM070I-500G), citrate medium (HiMedia M069-500G), and Triple Sugar Iron Agar (TSIA; Oxoid CM0277B, Oxoid, Hampshire, UK). Isolates showing an Indole, methyl red, Voges–Proskauer, and citrate (IMViC) pattern of (+ + − −) and TSIA reactions characterized by acid slant/acid butt with gas production and absence of hydrogen sulfide were classified as
Presumptive identification of E. coli O157
Biochemically confirmed
Molecular confirmation using multiplex PCR
Genomic DNA from all presumptive
Table 1. Primer sequences and expected amplicon sizes used for multiplex polymerase chain reaction.
| Target gene | Primer sequence (5′–3′) | Amplicon size (bp) |
|---|---|---|
|
| F: CGG ACA TCC ATG TGA TAT GG | 259 |
| R: TTG CCT ATG TAC AGC TAA TCC | ||
|
| F: GCG CTG TCG AGT TCT ATC GAGC | 625 |
| R: CAA CGG TGA CTT TAT CGC CAT TCC | ||
|
| F: CGT CTT TAC TGA TGA TTG ATA GTG GC | 637 |
| R: CGC GAT GCA TGA TGA TGA C | ||
|
| F: TAC CAC TCT GCA ACG TGT CG | 297 |
| R: CGA TAC TCC GGA AGC ACA TT |
The multiplex PCR assay targeted
Each PCR reaction was prepared in a total volume of 50 μL consisting of 25 μL PowerPol 2× PCR Master Mix (ABclonal Technology, Wuhan, China), 1 μL of each primer pair, 19 μL nuclease-free water, and 2 μL genomic DNA template. PCR amplification was performed using an initial denaturation step at 98°C for 45 s, followed by 30 cycles of denaturation at 98°C for 10 s, annealing at 57°C for 30 s, and extension at 72°C for 30 s, with a final extension at 72°C for 5 min.
PCR products were electrophoresed on 1.5% agarose gels stained with SYBR® Safe DNA Gel Stain (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) and visualized under ultraviolet transillumination. Isolates showing simultaneous amplification of
Antimicrobial susceptibility testing
Antimicrobial susceptibility testing was performed using the Kirby–Bauer disk diffusion method on Mueller–Hinton agar in accordance with the Clinical and Laboratory Standards Institute (CLSI) guidelines [25]. The antimicrobial agents tested included ampicillin (10 µg), tetracycline (30 µg), enrofloxacin (5 µg), streptomycin (10 µg), and trimethoprim–sulfamethoxazole (1.25/23.75 µg). Bacterial suspensions were prepared and adjusted to a 0.5 McFarland standard before inoculation onto Mueller–Hinton agar plates. Antibiotic disks were placed on the inoculated agar surfaces, then incubated at 37°C for 18–24 h.
After incubation, inhibition zone diameters were measured in millimeters and interpreted as susceptible, intermediate, or resistant [25]. The interpretive criteria used for each antimicrobial agent are presented in Table 2. Each isolate was tested in duplicate to ensure reproducibility, and the reported inhibition zone diameter for each antimicrobial represented the mean value of duplicate measurements. Interpretations were based on CLSI M100 Performance Standards for Antimicrobial Susceptibility Testing, 35th edition, for Enterobacterales.
Table 2. Interpretation standards for inhibition zone diameters used in the Kirby–Bauer disk diffusion method [25].
| No. | Antibiotic | Dose | Sensitive (S) (mm) | Intermediate (I) (mm) | Resistant (R) (mm) |
|---|---|---|---|---|---|
| 1 | Ampicillin | 10 µg | ≥17 | 14–16 | ≤13 |
| 2 | Tetracycline | 30 µg | ≥15 | 12–14 | ≤11 |
| 3 | Streptomycin | 10 µg | ≥15 | 12–14 | ≤11 |
| 4 | Trimethoprim–sulfamethoxazole | 1.25/23.75 µg | ≥16 | 11–15 | ≤10 |
| 5 | Enrofloxacin | 5 µg | ≥22 | 17–21 | ≤16 |
Detection of AMR genes
AMR genes were detected by PCR to identify resistance determinants associated with the antimicrobial agents evaluated in this study. The selected genes represented major resistance determinants frequently associated with mobile genetic elements in livestock-associated
The same genomic DNA extracted using the Quick-DNA™ Miniprep Plus Kit (Zymo Research, Irvine, CA, USA) was used as the template for PCR amplification of AMR genes. Primer sequences, expected amplicon sizes, and annealing temperatures are presented in Table 3 [29–31]. PCR reactions were prepared in a total volume of 25 μL consisting of 2 μL genomic DNA template, 12.5 μL PowerPol 2× PCR Mix with Dye V2 (ABclonal Technology, Wuhan, China), 0.5 μL forward primer (10 μM), 0.5 μL reverse primer (10 μM), and 9.5 μL nuclease-free water.
Table 3. Primer sequences and annealing temperatures used for antimicrobial resistance genes.
| Antibiotic class | Gene | Primer sequence (5′–3′) | Amplicon size (bp) | Annealing temperature (°C) | Reference |
|---|---|---|---|---|---|
| Penicillin |
| F: GCGGAACCCCTATTTG | 963 | 52 | [29] |
| R: ACCAATGCTTAATCAGTGAG | |||||
| Tetracycline |
| F: GCTACATCCTGCTTGCCTTC | 210 | 58 | [30] |
| R: CATAGATCGCCGTGAAGAGG | |||||
| Aminoglycoside |
| F: TGGCAGGAGGAACAGGAGG | 405 | 58 | [31] |
| R: AGGTCGATCAGACCCGTGC | |||||
| Sulfonamide |
| F: GGCAGATGTGATCGACCTCG | 405 | 60 | [30] |
| R: ATGCCGGGATCAAGGACAAG | |||||
| Fluoroquinolone |
| F: GCAAGTTCATTGAACAGGGT | 428 | 54 | [31] |
| R: TCTAAACCGTCGAGTTCGGCG |
PCR amplification was performed using an initial denaturation step at 98°C for 45 s, followed by 30 cycles of denaturation at 98°C for 10 s, annealing at temperatures specific for each primer pair (Table 3), and extension at 72°C for 30 s, with a final extension step at 72°C for 5 min. PCR products were separated by agarose gel electrophoresis and visualized under ultraviolet transillumination. An NTC containing all PCR reagents except DNA template was included in each PCR run to monitor contamination. Amplicon sizes were verified using a DNA ladder during electrophoresis.
RESULTS
Isolation and identification of E. coli
A total of 680 samples were analyzed, comprising 650 fecal specimens and 30 environmental samples. Cultural and biochemical examination identified
Table 4. Distribution of
| Quarantine facility | n |
| Shiga toxin-producing | Non-STEC | |
|---|---|---|---|---|---|
| Facility A | 130 | 125 | 2 | 2 | 0 |
| Facility B | 130 | 118 | 3 | 1 | 2 |
| Facility C | 130 | 128 | 7 | 6 | 1 |
| Facility D | 130 | 126 | 0 | 0 | 0 |
| Facility E | 130 | 128 | 4 | 2 | 2 |
| Total | 650 | 625 (96.15%) | 16 (2.46%) | 11 (1.69%) | 5 (0.76%) |
Presumptive identification of E. coli O157
Biochemically confirmed
Figure 2. Presumptive identification of
PCR confirmation of E. coli O157:H7
Multiplex PCR amplification targeting
Table 5. Isolation and molecular identification of
| Quarantine facility | Total samples |
| Shiga toxin-producing | Non-STEC | |
|---|---|---|---|---|---|
| Facility A | 136 | 130 | 2 | 2 | 0 |
| Facility B | 136 | 123 | 3 | 1 | 2 |
| Facility C | 136 | 132 | 7 | 6 | 1 |
| Facility D | 136 | 131 | 0 | 0 | 0 |
| Facility E | 136 | 133 | 4 | 2 | 2 |
| Total | 680 | 649 | 16 | 11 | 5 |
Figure 3. Multiplex polymerase chain reaction amplification of
Of the 16 confirmed
Figure 4. Multiplex Polymerase Chain Reaction amplification of
Antimicrobial susceptibility testing
Antimicrobial susceptibility testing of the 16
Table 6. Antibiotic susceptibility and resistance genes of
| No. | Antibiotic | Total tested | Sensitive | Intermediate | Resistant | Resistance gene |
|---|---|---|---|---|---|---|
| 1 | Ampicillin | 16 | 14 | 1 | 1 | 2 |
| 2 | Tetracycline | 16 | 11 | 0 | 5 | 7 |
| 3 | Streptomycin | 16 | 13 | 3 | 0 | 6 |
| 4 | Trimethoprim–sulfamethoxazole | 16 | 16 | 0 | 0 | 3 |
| 5 | Enrofloxacin | 16 | 14 | 2 | 0 | 3 |
| Total | 80 | 68 (85%) | 6 (7.5%) | 6 (7.5%) | 21 (26.25%) |
Figure 5. Representative antimicrobial susceptibility profile of
Resistant isolates were detected in facilities A, C, and E. Tetracycline resistance was identified in isolates from facilities A, C, and E, whereas ampicillin resistance was detected in only one isolate from facility C. No resistant isolates were detected in facility B or facility D. Analysis of resistance patterns showed that 11 of 16 isolates (68.75%) were susceptible to all tested antibiotics. Four isolates (25%) were resistant to a single antibiotic (tetracycline), whereas one isolate (6.25%) was resistant to two antibiotics (ampicillin and tetracycline).
Detection of AMR genes
PCR analysis revealed the presence of several AMR genes among the
Figure 6. Representative Polymerase Chain Reaction amplification profiles of antimicrobial resistance genes detected in
Overall, eight isolates (50.0%) carried at least one AMR gene. Five isolates (31.25%) carried multiple resistance genes. The most common gene combinations were
DISCUSSION
Prevalence of E. coli O157:H7 in imported cattle
This study provides the first characterization of
The prevalence of
Distribution of STEC and non-STEC isolates
Multiplex PCR analysis revealed that 11 of the 16 confirmed
In addition to STEC isolates, five strains (0.76%) were identified as non-STEC
Distribution among quarantine facilities
The distribution of
The distribution of STEC and non-STEC
Environmental contamination and biosecurity implications
The results of environmental sampling from soil, wastewater, and drinking water collected from the quarantine facilities are presented in Table 7. Environmental sampling detected commensal
Table 7. Environmental detection of
| Quarantine facility | Soil n | Soil | Soil | Wastewater n | Wastewater | Wastewater | Drinking water n | Drinking water | Drinking water |
|---|---|---|---|---|---|---|---|---|---|
| Facility A | 4 | 4 | 0 | 1 | 1 | 0 | 1 | 0 | 0 |
| Facility B | 4 | 4 | 0 | 1 | 1 | 0 | 1 | 0 | 0 |
| Facility C | 4 | 4 | 0 | 1 | 0 | 0 | 1 | 0 | 0 |
| Facility D | 4 | 4 | 0 | 1 | 1 | 0 | 1 | 0 | 0 |
| Facility E | 4 | 4 | 0 | 1 | 1 | 0 | 1 | 0 | 0 |
| Total | 20 | 20 | 0 | 5 | 4 | 0 | 5 | 0 | 0 |
Phenotypic antimicrobial susceptibility patterns
Phenotypic antimicrobial susceptibility testing showed that most
Genotype–phenotype discordance of AMR determinants
Despite the largely susceptible phenotypic profile, molecular analysis revealed the presence of AMR genes including
Biosecurity significance of plasmid-mediated resistance genes
The detection of plasmid-mediated resistance genes such as
Study novelty and One Health relevance
Although the prevalence observed in this study falls within the range reported in Australian cattle production systems [8], the novelty of this work lies in its focus on the import–quarantine stage of the international livestock trade pathway. Most previous studies investigated
Study limitations and future perspectives
This study has several limitations. First, the number of confirmed
Despite these limitations, the present study provides novel data on virulence profiles and latent AMR genes in imported cattle during the quarantine phase of international livestock trade. Future studies involving longitudinal sampling during transport and post-distribution stages would further improve understanding of pathogen dynamics in the global beef supply chain.
CONCLUSION
This study demonstrated that imported Australian beef cattle during quarantine in Indonesia carried
The findings highlight the epidemiological significance of imported cattle as potential carriers of transferable AMR determinants, despite their predominantly susceptible antimicrobial profiles. The detection of plasmid-mediated resistance genes in phenotypically susceptible isolates emphasizes the limitation of relying solely on conventional susceptibility testing and supports the integration of molecular-based AMR surveillance into routine quarantine monitoring systems. From a practical perspective, strengthening molecular screening at quarantine entry points could improve early detection of zoonotic pathogens and latent resistance determinants, thereby supporting biosecurity, food safety, and One Health-based antimicrobial stewardship programs in importing countries.
A major strength of this study was the combined evaluation of prevalence, virulence-associated genes, phenotypic antimicrobial susceptibility, and molecular determinants of resistance during the quarantine stage of international livestock trade, a critical yet underexplored point in pathogen surveillance. In addition, the inclusion of both fecal and environmental sampling provided broader insight into the potential environmental dissemination of AMR determinants associated with imported cattle.
Overall, this study provides important baseline epidemiological data regarding
DATA AVAILABILITY
The data generated during the study are included in the manuscript.
AUTHORS′ CONTRIBUTIONS
SRA, WSN, and WS: Conceptualization, study design, data analysis, and interpretation. SRA: Sample collection, laboratory analysis, and Writing – original draft preparation. WSN and WS: Supervision and critical revision of the manuscript. All authors have read and approved the final version of the manuscript.
COMPETING INTERESTS
The authors declare that they have no competing interests.
PUBLISHER’S NOTE
Veterinary World remains neutral with regard to jurisdictional claims in the published map and institutional affiliations.
ACKNOWLEDGMENTS
The authors gratefully acknowledge financial support from the Indonesia Endowment Fund for Education (LPDP) and the Inter University Center for Excellence (IUCfE) Program 2024–2025. The authors also thank the Animal, Fish, and Plant Quarantine Center of DKI Jakarta and the Indonesian Agricultural Quarantine Agency for providing access and technical assistance during field sampling and for coordinating quarantine site activities. The authors further acknowledge all staff members of the Department of Veterinary Public Health, Faculty of Veterinary Medicine, Universitas Gadjah Mada, for their assistance with laboratory analyses.
REFERENCES
- Saxena T, Kaushik P, Mohan MK. Prevalence of
Escherichia coli O157:H7 in water sources: An overview on associated diseases, outbreaks and detection methods. Diagn Microbiol Infect Dis 2015;82(3):249-264. [Google Scholar] | [Crossref] - Holmes AH, Moore LSP, Sundsfjord A, Steinbakk M, Regmi S, Karkey A. Antimicrobial resistance in enteric bacteria under a One Health lens. Nat Rev Microbiol 2022;20(4):175-190. [Google Scholar] | [Crossref]
- Mthembu TP, Zishiri OT, El Zowalaty ME. Molecular detection of multidrug-resistant
Salmonella isolated from livestock production systems in South Africa. Infect Drug Resist 2019;12:3537-3548. [Google Scholar] | [Crossref] - Lubroth J. The global framework for the progressive control of transboundary animal diseases: Strengthening infectious disease management and veterinary systems across the continents. Vet Clin North Am Food Anim Pract 2024;40(2):233-249. [Google Scholar] | [Crossref]
- Statistik impor sapi potong Indonesia 2015–2024. Retrieved on 2025 Nov 10. [Available from] | [Google Scholar]
- 21 of 2019 on Animal, Fish, and Plant Quarantine. Government of Indonesia, Jakarta 2019. [Google Scholar] | [Crossref]
- Lammers GAC, McConnel CS, Jordan D, Ayton MS, Morris S, Patterson EI. Synchronization of
Escherichia coli O157 shedding in a grass-fed beef herd: A longitudinal study. Epidemiol Infect 2015;143(15):3244-3255. [Google Scholar] | [Crossref] - Mellor GE, Fegan N, Gobius KS, Smith HV, Desmarchelier PM. National survey of STEC serotypes including O157 in Australian beef cattle feces. Appl Environ Microbiol 2016;82(17):5093-5102. [Google Scholar] | [Crossref]
- Ahlstrom CA, Duffy LL, Bull RA, Bond C, Fegan N, Jordan D. Characterization of
Escherichia coli O157:H7 from Australian cattle indicates sporadic occurrence and genetic diversity. Foodborne Pathog Dis 2017;14(5):286-293. [Google Scholar] | [Crossref] - Carroll LM, Wiedmann M, den Bakker HC, Siler J, Warchocki S, Kent D. Association of
Escherichia coli O157:H7 presence with cattle, environment, and management practices on dairy farms. Appl Environ Microbiol 2020;86(9):e02820-19. [Google Scholar] | [Crossref] - Jiang X, Morgan J, Doyle MP. Fate of
Escherichia coli O157:H7 in manure-amended soil. Appl Environ Microbiol 2002;68(5):2605-2609. [Google Scholar] | [Crossref] - Galarce N, Escobar B, Sánchez F, Rojas X, Neira V, Hamilton-West C. Phenotypic and genotypic antimicrobial resistance in non-O157 Shiga toxin-producing
Escherichia coli isolated from cattle and swine in Chile. Front Vet Sci 2020;7:367. [Google Scholar] | [Crossref] - Cao Y, Wang Y, Chen Y, Shen Z, Han J, Zhang S. Prevalence and characterization of tetracycline resistance genes in
Escherichia coli isolated from food-producing animals. Food Control 2020;108:106836. [Google Scholar] | [Crossref] - Feng P, Weagant SD, Jinneman K. Escherichia coli. In: Bacteriological Analytical Manual U. S. Food and Drug Administration, Silver Spring, MD 2020. [Google Scholar] | [Crossref]
- Ferens WA, Hovde CJ.
Escherichia coli O157:H7: Animal reservoir and sources of human infection. Foodborne Pathog Dis 2011;8(4):465-487. [Google Scholar] | [Crossref] - Martin SW, Meek AH, Willeberg P. Veterinary Epidemiology: Principles and Methods. Iowa State University Press, Ames 1987. [Google Scholar] | [Crossref]
- Croxen MA, Law RJ, Scholz R, Keeney KM, Wlodarska M, Finlay BB. Recent advances in understanding enteric pathogenic
Escherichia coli . Clin Microbiol Rev 2013;26(4):822-880. [Google Scholar] | [Crossref] - Madigan M, Bender K, Buckley D, Sattley W, Stahl D. Brock Biology of Microorganisms. Boston, MA: Pearson Education; 2021. [Google Scholar]
- March SB, Ratnam S. Sorbitol-MacConkey medium for detection of
Escherichia coli O157:H7 associated with hemorrhagic colitis. J Clin Microbiol 1986;23(5):869-872. [Google Scholar] | [Crossref] - Scientific opinion on the risk posed by Shiga toxin-producing
Escherichia coli (STEC) and other pathogenic bacteria in seeds and sprouted seeds. EFSA J 2011;9(11):2424. [Google Scholar] | [Crossref] - Haile AF, Alonso S, Berhe N, Atoma TB, Boyaka PN, Grace D. Prevalence, antibiogram, and multidrug-resistant profile of
Escherichia coli O157:H7 in retail raw beef in Addis Ababa, Ethiopia. Front Vet Sci 2022;9:734896. [Google Scholar] | [Crossref] - Kwan G, Johnson PD, Gillespie B. Limitations of phenotypic screening for STEC detection in cattle. Vet Microbiol 2019;231:180-188. [Google Scholar] | [Crossref]
- Lucatelli A, Monte DFM, Alvares PP, Guth BEC, Destro MT, Franco BDGM. Virulent shiga toxin-producing
Escherichia coli (STEC) O157:H7 ST11 isolated from ground beef in Brazil. Braz J Microbiol 2024. [Google Scholar] | [Crossref] - Oh KH, Kim SB, Park MS, Cho SH. Development of a one-step PCR assay with nine primer pairs for the detection of five diarrheagenic
Escherichia coli types. J Microbiol Biotechnol 2014;24(6):862-868. [Google Scholar] | [Crossref] - Performance Standards for Antimicrobial Susceptibility Testing. CLSI, Wayne, PA: CLSI Supplement M100; 2025. [Google Scholar]
- Barton MD, Pratt R, Hart WS. Antibiotic resistance in animals. Commun Dis Intell Q Rep 2003;27((Suppl.)):S121-S126. [Google Scholar] | [Crossref]
- Murray CJL, Ikuta KS, Sharara F, Swetschinski L, Robles Aguilar G, Gray A. Global burden of bacterial antimicrobial resistance in 2019: A systematic analysis. Lancet 2022;399(10325):629-655. [Google Scholar] | [Crossref]
- Scientific opinion on STEC in food and animals. EFSA J 2022;20(5):e07212. [Google Scholar] | [Crossref]
- Jafari E, Moghaddam M, Lotfollahi L, Bahador A. Molecular characterization of β-lactamase-producing diarrheagenic Escherichia coli isolates. Ann Clin Microbiol Antimicrob 2021;20:24. [Google Scholar] | [Crossref]
- Vuthy Y, Lay KS, Seiha H, Kerleguer A, Aidara-Kane A. Antibiotic susceptibility and molecular characterization of resistance genes among Escherichia coli and Salmonella isolates from chicken food chains. J Food Saf Food Qual 2017;68(4):123-131. [Google Scholar] | [Crossref]
- Jeamsripong S, Thaotumpitak V, Anuntawirun S, Roongrojmongkhon N, Atwill ER, Hinthong W. Molecular epidemiology of antimicrobial resistance and virulence profiles of Escherichia coli, Salmonella spp., and Vibrio spp. isolated from coastal seawater for aquaculture. Antibiotics (Basel) 2022;11(12):1688. [Google Scholar] | [Crossref]
- Rangel JM, Sparling PH, Crowe C, Griffin PM, Swerdlow DL. Epidemiology of
Escherichia coli O157:H7 outbreaks, United States, 1982–2002. Emerg Infect Dis 2005;11(4):603-609. [Google Scholar] | [Crossref] - Melton-Celsa AR. Shiga toxin (Stx) classification, structure, and function. Microbiol Spectr 2014;2(3). [Google Scholar] | [Crossref]
- Smith DR, Renter DG, Cernicchiaro N, Shi X, McMillan K. Population dynamics, management factors, and antimicrobial resistance patterns of
Escherichia coli in cattle production systems. Front Vet Sci 2021;8:666198. [Google Scholar] | [Crossref] - Mellor GE, Fegan N, Duffy LL, McMillan KE, Jordan D, Barlow RS. Prevalence and concentration of Shiga toxin-producing
Escherichia coli in Australian beef cattle at slaughter. Appl Environ Microbiol 2016;82(15):4405-4415. [Google Scholar] | [Crossref] - Gally DL, McNeilly TN, Low JC. Epidemiology and ecology of
Escherichia coli O157:H7 in cattle. Microbiol Spectr 2020;8(5). [Google Scholar] | [Crossref]